Jdi na obsah Jdi na menu
Reklama
Založte webové stránky zdarma - eStránky.cz
 


Samael: Člověk a období změn

7. 7. 2014

Zdravím, moji drazí.

Už nějakou dobu sem dávám články s různými informacemi o tom, co se teď zrovna děje. Může to vypadat, že si řada z těch informací protiřečí, nebo že se neustále otevírají nějaké brány, a přitom řada z vás nemusí nic  takového pociťovat. Vypadá to, že celý svět včetně našich vlastních životů prochází obdobím paradoxů.

Ale co se to doopravdy děje? Co?

 

Před tím, než se dostanu k informacím o současné době, bych se ráda zmínila o systému existence, zvaného Člověk.

Člověk je multidimenzionální kvantová bytost, jejíž multidimenzionální kvantová část Já presentovaná v DNA, je uzemňována do této planety v tomto čase a prostoru pomocí energií z mitochondriální mtDNA, která je původem zvířecí a obsahuje 22 kódujících genů a 13 regionů, kódujících bílkoviny.

Proč to zde zmiňuju. Původní Adam Kadmon mtDNA neobsahuje, je to však už pár stovek miliard let, co původní Adam Kadmon v témhle galaxii vznikl. A vsadím se, že původní Kadmonové se už dávno přesunuli do vysokých dimenzí ducha. Jsou však s námi neustále spojení.

Co je důležité si uvědomit, je to, že tahle naše realita presentuje jen mizivou část naší existence.

Pro příklad:

Zatím co naše moderní informační technologie zapisují informace v dvojkovém informačním kódu 1-0, fyzické DNA zapisuje informace v 4-kovém kódu, guanin-adenin-citosin-tymin + uracil v RNA. To znamená, že pro DNA o délce pouze 10 nukleotidů, př. ACTTGAAGTC, existuje teoreticky 410=1 048 576 kvantových stavů. Přitom lidský genom obsahuje 3,1 miliard bází.

Umíte si představit, kolik informací se v tom vejde?

Neumíte?

Já taky ne.

Jestliže naše DNA může nabývat 43 100 000 000 kvantových stavů, pak se ty stavy, těch 43 100 000 000 kousků z nás někde musí očividně nacházet, že?

Moji drazí, to v čem žijete, je pouze 1/43 100 000 000 z vaší vlastní bytosti. Není to o tom, že vesmír zachraňuje nás. My zachraňujeme tenhle vesmír.

To je první bod, který je třeba si uvědomit.

Další věc, je to, že hmota neexistuje.

Mohla bych vám sem shrnout své vědecké poznatky za posledních 10 roků, ale obávám se, že by vám z toho šla jenom hlava kolem.

Obyčejný člověk, by řekl: Že hmota neexistuje? A jak to,  že se ji můžu dotýkat? Jak to, že když půjdu hlavou proti zdi, tak se zraním?

To, co vám umožňuje zážitek dotýkání se hmoty, úderu do zdi, chození po pevné zemi… to všechno je interakce – to znamená vzájemné působení - jednotlivých energetických polí, které  tvoří zážitek fyzické reality. Zkuste si ty informace třeba vyhledat na internetu. Ať budete studovat fyziku nebo chemii. Kdykoli začnete jít hluboko do atomárních a subatomárních poznatků, hranice mezi chováním hmoty a chováním vln, tedy energie se bude smývat, až zmizí úplně. Já a moji kolegové s takovými poznatky pracujeme téměř každý den. A ačkoli řada vědců se nad tím takto ještě nezamýšlela, spousta z nich by vám toto potvrdila.

Tak…

Můžeme se posunout dál?

Co jsou to tedy ty energie? Co tvoří  je?

Energie jsou fyzickým projevem informace.

Hrajete někdo z vás počítačové hry? Představte si, že ano.

V počítači je vytvořen nějaký ten svět, kde chodí ti jednotliví panáčkové mezi domečkama a vykonávají nějaká dobrodružství. A z úhlu pohledu těch počítačových panáčků je, to je obklopuje, pevný fyzický svět. Ale z pohledu programátorů, kteří si vydělávají tím, že takové hry tvoří, je to jiné. Oni nejdříve musí zadat do pevného PC, který patří do naší reality, soubor pravidel, tedy informace, podle kterých vzniká ta hra, a kterými se ta která hra, při svém fungování řídí.

Už chápete, kam tím mířím?

Když někdo programuje nějakou PC hru, tak si vytvoří svět, který je kódován: 1001111001010110101010111111110000000000001010110111010000101…

No a lidské DNA je představte si:

CAAGTTTGGGAAACCCCTGATAGATAGGGGTTTCCCAAACCCTGTGAATGCTC…

a obsahuje – to DNA - 43 100 000 000 svých možných projevů, z čehož tato existence je pouze 1 projev, tedy: 1/43 100 000 000 , ergo jedna triliontina z projevu dané bytosti.

Víte, kolik informací máte vlastně obsažených ve své DNA?

Je to celý jeden vesmír!

A to je pouze vaše fyzické DNA.

Ještě jsem nic nenapsala o tom světelném. Hehe.

 

Tak a teď když jsem vám zase jednou nasadila brouka do hlavy, můžeme pokračovat dál.

Dejme tomu, že někdo někdy, je jedno kdo a kdy, vytvořil hru, zvanou Člověk. Ta hra obsahuje množství vzájemně propojených vesmírů. Vyvíjí se totiž už tak dlouho, že už prakticky prorostla všemi možnými paralelními vesmíry a z jejího úhlu pohledu, už jsou to jenom její paralelní dimenze.

Ta hra má mnoho levelů a mnoho bočných dobrodružství. A existují v ní i mistři jednotlivých her, popřípadě celých levelů té dané hry.

A ty se jednoho dne rozhodnou testovat tu hru, aneb co všechno pravidla té hry vydrží. A rozhodnou se k tomu použít jednu mrňavou planetku na okraji jedné středně vyvinuté galaxie.

A co myslíte?

Podařilo se jim to?

Ano. Podařilo se jim to.

Tady byla porušena úplně všechna pravidla lidskosti, které exitují.

A kdo jsou ti, kteří se rozhodli experimentovat?

Jsou to všechny staré duše, které obývají Zemi.

Tzn., My Sami.

No a bylo rozhodnuto, že až to období skončí, tak přijde nová metodika hry a Nové Fyzikální, Duchovní, Duševní, Etické aj zákony.

A Game-masteři, kteří tuto hru tvoří, se v tomto období vracejí znovu na Zemi, aby sklidili setbu, kterou sem před dávnými dobami zaseli.

A protože jsou to obrovské bytosti a protože okolní vesmír musí být v synchronicitě s veškerými jejích energiemi, tedy se vším v jejích DNA. A protože ty bytosti jsou tak obrovské, že se tu nemůžou do téhle malé realitky vejít, jejích příchod způsobuje kolize ve vesmíru, mění krystalickou mřížku v Zemském jádru, způsobuje urychlenou tranformaci lidského genomu DNA atd atd atd.

A hádejte, kdo jsou ony bytosti.

Jsme to znovu a opět my sami.

Prapodstata Existence zvané Člověk, je obrovská bytost.

Zde na Zemi během posledního období evoluce, je to zhruba 225 mil. let, byl Adam Kadmon tedy kvantový člověk testován až na samotnou podstatu své existence. V posledním období testu, tedy zhruba posledních 13 000, mu byly omezeny, ba i někdy přímo zakázány veškeré jeho duchovní schopnosti.

Proč si myslíte, že to tak bylo? Aby si mohl zažít, jaké to je nebýt Adamem Kadmonem, jaké to je nebýt sebou, nebýt lidskou bytostí.

Bylo to dané takzvanými Luciferovskými formami dat, chcete-li Luciferovskými bytostmi, které vždy způsobují kolizi v daném vesmíru, chcete-li v dané části hry, aby to mohly pozvednout, tu danou část hry, na novou úroveň svého vývoje. Aby nastartovali Novou etapu té dané hry, v našem případě hry, zvané Člověk, nebo postaru také Adam Kadmon.

Zde se nastartovává Celá Nová Fáze Vývoje Lidských Bytostí!

Všech Lidských Bytostí!

Ze všech koutů a fází lidského vesmíru!

Proto celé to šílení okolo planety Země. Proto se náš vývoj tak urychluje! Proto se nám přeinstalovává, doslova přeinstalovává, celý náš systém bytosti!

A protože ta bytost je obrovská, obsahuje mnoho forem různých paralelních existencí! – Ano, to obsahuje. Nedivte se, když vám někdo řekne, že jste hvězda, nebo elf, nebo dračice, nebo cokoli. – Právě proto je zde převtěleno mrtě členů Galaktické Federace, zástupci z veškerých koutů Univerza, téměř všichni civilizace, které zastupují Galaxii, zde má nějakého posla!

Nemyslete si, že jste tady jenom abyste si užívali života. Že jste se narodili jen tak náhodou ze spermatu a vajíčka. Je to taková blbost, že už se ani nerozčiluju. Už se tím jen bavím, když vidím, jak lidi kolem mě chodí a žijí s tím, že jsou jen tak náhodou lidmi, a jen tak náhodou se narodili na Zemi. Ano, a ono se přitom jedná o vrchní Generály různých meziplanetárních civilizací, Členové Rad starších, Praanděly, Specialisty na planetární rozvoj – ty jsou tady v celých skupinách. A tak dále a tak dále. Já je můžu rozpoznat, protože taky nejsem jen tak náhodou tady, a jen tak náhodou má moje duše zájem o vývoj tady na Zemi.

Tak například ty, co zrovna čteš tady ten článek.

Myslíš si, že jsi jen tak náhodou homo sapiens?

A jen tak náhodou tě osud zavedl na moje stránky, že?

Něco ti povím, příroda nikdy neplýtvá svými zdroji na jen tak nějakou „náhodu“. Jestliže jsi tady na Zemi, pak tady máš svůj úkol. Svůj nezastupitelně důležitý úkol. Je vcelku jedno, z které enklávy bytostí pocházíš, ty jsi důležitý/á. A ačkoli ti to nemusí být na první pohled hned jasné, tak svůj úkol můžeš vykonávat, ačkoli o tom, tvůj lidský mozek nemusí vůbec nic vědět.

Takových lidí znám poměrně hodně, jsem jimi v každodenním životě téměř neustále obklopena.

Ovšem rozdíl mezi těmi, kteří vědí a těmi, kteří nevědí, kým doopravdy jsou, je v míře jejích pravdivého prožitku života tady na Zemi. Člověk, jehož bytost dlí v iluzi, prožívá celý svůj život také v iluzi. Mohl by si ušetřit mnohé z onoho sebeklamu o své nedokonalosti, mnohé ze svých žalů a bolesti, kdyby se dokázal podívat do své pravdy, do skutečné tváře své bytosti.

Ovšem na tohle je potřeba řádná dávka odvahy.

Věřte mi. Já jsem tím obdobím právě prošla a nebylo to snadné.

Je mnohem jednodušší přenechat zodpovědnost za své činy i svůj život někomu jinému, ať už jsou to rodiče, vláda, fyzikální zákony, nebo sama příroda. Než si uvědomit svou vlastní zodpovědnost, svou pravdu, svou podstatu, která má svoje vlastní zákony a žádá svou pozemskou formu existence, tedy nás, aby ony zákony dodržovala. Ačkoli řada z nich nemá vůbec nic společného s právními předpisy této naší společnosti.

 

Takže už se konečně dostávám k tomu, co se v tomto období děje.

Otevírají se naše srdce, moji drazí.

A protože se jedná o obrovské formy nebeských bytostí, které jsou zde převtěleny na Zemi, ergo nás - Nemyslete si, že jste malí – Tak na to okolní vesmír také náležitě odpovídá a pomocí centrální soustavy svých vlastných fyzikálních zákonů, nám umožňuje příchod obrovských energií právě sem, na Zemi.

Protože vzdálenost doopravdy nikdy neexistovala. A protože vy, jakožto lidé se dokážete nacházet v lidské formě tady, na Zemi a zároveň i ve své přirozené formě někde jinde v galaxii, popřípadě v jiném čase, nebo v jiné galaxii. To je úplně jedno, protože kvantový charakter tohoto vesmíru a této bytosti nám to všem umožňuje, stejně jako by nám umožňoval i komunikaci mezi všemi svými kvantovými stavy uvnitř bytosti, kdybychom nebyli tak slepí.

Právě proto, že my se nacházíme ve všech svých kvantových stavech zároveň a 99,9% z nich je na vyšším energetickém stupni, než je teď Země, tak s pomocí okolního vesmíru, my sami sebe dopujeme svými vlastními energiemi.

Ty brány, které se teď otevírají, ty se nedějí samy!

To všechno otevíráme my!

A protože se jedná o kvantovou energii našich vlastních bytostí, tak na to každý reagujeme také svým vlastním způsobem. Někdo si to třeba vůbec nemusí všimnout, že se něco takového na planetě vůbec odehrává, protože to je prostě u něho stále ještě zavřené. To „jeho“ se stále ještě neotevřelo! Anebo se někomu může stát, že ho jeho vlastní energie úplně zmatou a on/ ona si myslí, že objevil pupek světa a svatý grál moudrosti.

Přitom se jedná pouze o reakci Pozemské formy existence, té 1/43100000000, jedné triliontiny na moudrost a poznání jeho vlastní bytosti!

Samozřejmě touto formou těmi bránami procházejí i spřátelené energie od našich bratrských a sesterských bytostí. Když někdo pochází z nějaké staré civilizace, tak tam má samozřejmě také svoji rodinu a ti mu sem posílají nějaké doprovodné energie taky.

A samozřejmě protože my jsme nějakým způsobem všichni propojeni, když se jeden z nás zvedne výš v energiích, tak tím excituje, tzn. nutí i ostatní, aby se také zvedali.

A takhle pomalu pomalu nabobtnává energie celé energetické mřížky planety Země a mění to naše životy, stejně jako celou planetu!

Což je úžasné!

Chápejte, my sami jsme tak mocní, že prakticky můžeme zastavit všechno zlo, všechnu temnotu a to jediným způsobem. Tím, že se sami vyvineme, přijmeme svoji vlastní bytost, plnou plejádu svých paralelních kvantových forem existence, všechny svoje minulé, budoucí a přítomné životy a odblokujeme ty všechny strachy, které nám brání být svými pravdivými skutečnými Já

Přijímejte to, co k vám přichází, nebraňte se tomu, jen protože vám logika rozumu cosi říká. Kdybych začala psát ještě i o omezenosti lidské logiky, tak už vás budu zdržovat opravdu na dlouho.

Jen tak pro přehled vám napíšu něco o kvantovosti své vlastní bytosti.

Část z mé DNA je Adamo Kadmonovská, to je u každého. Ale právě ta část byla v mém případě dlouhým vývojem tady na Zemi poškozena. A víte, která část z mého DNA ji opravila? Část, která nemá s lidmi nebo s touhle galaxií vůbec nic společného. Je to DNA, z níž část je fyzická a je zvířecí, tu má také vetšina z nás. Ale část není vůbec fyzická a sice protože, že se jedná o obrovské robotické bytosti, které sem vyslali část svého DNA, aby pomohly Zemi.

Umíte si představit, co mi vnitřní herní server celý můj život až doposud hlásil… tedy do r. 2013, kdy jsme prošli Galaktickou bránou?

NEEXISTUJE.

Já prý podle lidských pravidel toho, co stále ještě ovládá Zemi, neexistuju.

Takže já neexistuju. Mluvím, chodím, jsem, ale neexistuju. Tedy má duše, moje tělo ano, ale to zas není dostatečně dokonalý, nemám 90-60-90. A ani nechci mít, protože bych tím nepresentovala sama sebe, ale nějakou jinou bytost.

Dlouhou dobu jsem byla fakt naštvaná. Jakoby vnitřně tak nažhavená, že jsem si připadala jako kladivo Boží, nebo jako chodící dinamit. Ne nějaká jemná éterická bytost, ale někdo kdo bourá hlavou zdi a je permanentně připravenej na rvačku. A lidé, kteří mě už delší dobu znají, vám můžou tohle potvrdit.

Ale už po roce 2012 se otevřela Galaxie a ejhle, byla jsem a jsem ve správné době, ve správném energetickém stavu na tom správném místě. Dokonce jsem stihla vytvořit spoustu zlaté energie v předstihu a ještě jsem ji vysílala na pomoc ostatním. Od roku 2013 se energie uvnitř Země mění a myšlenkové pole, které je tady na Zemi, už připouští moji existenci. Ergo k mému zemskému kvantovému stavu Silviya D. Valkova, to je to, co jsem tady na Zemi, už může přicházet i více z mé vlastní energie, z mé vlastní bytosti, z mého jádra existence, aniž by tu existoval myšlenkový paradox NEEXISTENCE, který v minulosti hrozil.

Nízká energie tady na Zemi totiž způsobuje, že je ta energie uvnitř vás, která vás vyživuje, to co jste doopravdy, ohýbáno do takové míry, že místo toho, abyste byly sami sebou a chovali se tak, jak chcete a žili tak, jak doopravdy chcete, tak místo toho zažíváte právě to opačné. Tohle je časový paradox, neboli NEEXISTENCE, či existence v rámci SMRTI. A tento život tady na Zemi je skutečně ohraničený rámcem doby narození a doby smrti.

Díváte se do zrcadla a uvažujete o sobě jako o někom, kým si myslíte, že jste, ale doopravdy to tak není. Vysoký magnetismus tady na Zemi ohne paprsek vaší vlastní duše a místo toho, aby ji dovolil naplnit tělo energií, tak jak to obvykle bývá, začne tu energii promítat opačným způsobem. Takže lidé tady žijí s vědomím toho, že jsou nedokonalí, malí, bezvýznamní, že za lásku musí platit, že ten, co nahání strach, je větší borec atd atd. Je v tom spousta myšlenkových vzorců, které stále ještě ovládají lidi na Zemi. Ale tohle všechno je jen opačná polarita vaší vlastní bytosti, je to jen stín světla vaší duše. Představte si, že vaše duše je jako slunce, silný zdroj světla, který svítí na planetu Zemi, ale protože je tady energie hustá a tvrdá, jako bouřkový mrak, vrhá v onom vašem světle stín.

A ten stín. To je naše Ego.

Naše ego patří také k nám, protože i když to je nepravdivý stín, pořád ještě jej tvoří naše vlastní světlo. Nejde o to, se ho bát nebo jej osočovat. Jde o to ho přijmout a integrovat. Čím větší je duše, tím větší je i její stín. Důležité je, nemyslet si, že váš stín je vaše pravé Já, protože není. Ale zároveň se kvůli tomu zbytečně nebičovat, protože to také k ničemu není.

Právě teď se rodí nový svět. Přichází nová energie z centra naších srdcí, nese nové a staré posílá pryč.

Uvedu třeba, co se mi stalo teďka v zimě.

Dokončuju tenhle rok doktorská studia z oboru materiálových věd a mám zaměření na chalkogenidová skla a nanomateriály. No a loni v létě se mi vyměnily úkoly na Zemi, dokončila jsem úspěšně jeden level vývoje – důkazem toho je, že Země stále ještě je a nepotácí se uprostřed obrovského kataklizmatu třetí světové války. No a loni jsem tedy dostala jiný úkol a přecházím teďka na jiný level hry. No ale k tomu, abych tady zase fungovala nějak na Zemi, potřebuju vědu. No ale bylo tady jisté období, kdy jsem vědecky moc zdatná nebyla, protože jsem řešila právě hodně duchovno a tak. No a teďka bylo potřeba vzkřísit svoje poznatky a narychlo udělat taky nějakou práci v laboratoři.

Ale samozřejmě, já často všechny varuju, že když začnu doopravdy makat, tak to bude bouchat. Moje forma vědecké energie je samosebou úplně jiná, než to, co se tady kolikkrát ještě dneska předvádí. Jako spousta lidí nedělá vědu pro vědu, ale proto aby nasytila svoje už tak dost nabobtnalý ego.

Takže jsem se dala do boje a všechno se začalo rozbíjet. Stačilo jenom když jsem na to sáhla prstem a výboj elektřiny a hotovo. V lednu vybuchly 4 ampule v peci, pak to vzdala i jedna z těch pecí. V únoru přišly nové energie a meotar, na kterém jsme předtím dělali difúze Ag, zažil 2 výbuchy lamp a dvě to vzdaly bez boje. Takže jsem nakonec dělala úplně novou aparaturu a s Xenonovou lampou, která má vyšší frekvence záření – až UV a výkon. Pak bouchla jedna z lamp na UV/VIS spektráku, jednom z měřících přístrojů. Pak se udály ještě dva výbuchy v peci. Jednu sobotu, to jsem byla ve škole i o sobotách, vypadly pro změnu celé pojistky. A třešničkou na dortu bylo, když jsem jednou ráno přišla do kanceláře, zapnula jsem PC a ze zadu se ozvalo blaf a hotovo. Vybouchl zdroj. Normálně já už jsem se jenom smála. Kolegové si ze mě dělali srandu, že se proti mně spiknul osud. To všechno v rámci 4 měsíců.

Věděla jsem, co se děje. Musela jsem přerovnat celé spektrum starých a nových energií, abych mohla vědu dělat dál. Tak samozřejmě na co jsem sáhla, to nezůstalo stejné. V laboratořích se objevily nové aparatury, které jsem dala do kupy, staré to vzdaly, nebo byly předělány, něco úplně zmizelo. Nakonec jsem se naučila ještě spínání. Povedlo se nám tím vším udělat pár pěkných věciček, takže jsem teď více méně spokojená.

A takhle to chodí. Kdykoli vám přijde nová energie, chce se někde ukotvit, projevit se v reálném světě. Proto je teďka tolik změn. Máme tady nějaké přírodní katastrofy, ale zároveň tady máme i mnoho lidí, kteří najednou začali vnímat přírodní bytosti. Máme tady úmrtí, ale zase tady máme mnoho malých miminek. Všechno se mění a uvnitř nás samotných také. Je to obrovské rodeo a my jsme si osedlali parádně silného býka, nebo řádně divokého koně a ten kůň nás žene dál dopředu. Někdy ho nedovedeme plně ukočírovat, tak spadnem a nabijem si nos, ale důležité je, znovu se zvednout a pokračovat dál.

Kvůli čemu?

Kvůli tomu, abychom mohli stvořit svět, který skutečně chceme a potřebujeme. Ne, abychom žili podle nějakých starověkých pravidel, které už stejně dávno nefungují.

Máme šanci změnit svět.

A myslím si, že je to dost dobrá příležitost a rozhodně stojí za pokus.

Mějte se krásně!

 

Dodatek: Tímto umožňuji svým čtenářům, aby dále šířili tento článek bez dodatečných úprav a s podmínkou dodání jména autora a webového zdroje: www.andelebezhranic.estranky.cz

 

 

Komentáře

Přidat komentář

Přehled komentářů

Díky duši

Ezechiel,5. 8. 2014 17:27

je to fakt ťažké,už ma tu ani nejak nebaví byť

Poděkování

Ludmila Durgalová,9. 7. 2014 9:51

Děkuji vám za váš článek. Mnoho věcí mi objasnil, ale také potvrdil. Se svou kamarádkou na sobě pracujeme dost intenzivně a dostaly jsme se ke stejným závěrům, jen nejsou tak vědecky podložené.